Bio112 Home

Answers to these Questions

Bio112 Study Questions

"transcription/translation, mutation, splicing"

Chapters 15, 16, 18

A cell is signaled to divide by a growth factor binding to one of its cell surface receptors. A signaling cascade is activated in the cytoplasm that results in changes in transcription of a variety of genes in the nucleus. One of the new mRNAs that appears in the cytoplasm has the following sequence:

5'GUAUCGCGAUCGCGAUGUAUAUUCCUCCCGAAGAAGAGU AAGCAUGGUACAACCGAUAAAAAAAAAAAAAAAAAAAAAA3'

Let's call this gene "Cheer" and let's say that the function of the protein encoded by the Cheer gene is to bind to MPF - the protein complex that triggers cells to divide.

1a,b,c. Using the amino acid full names (1a), the amino acid three-letter codes (1b), and the amino acid single letter codes (1c), what is the primary sequence of the peptide translated from this mRNA? For the three letter and single letter codes, refer to your amino acid handout from January.
1d. How many nucleotides long is the 5' UTR?
1e. Excluding the poly-A tail, how many nucleotides long is the 3' UTR?

2. If the Cheer gene has no introns, what is the sequence of the gene beginning at the transcription start site? To answer this, assume that the nucleotide sequence designating poly-adenylation is downstream of the poly-A site. Indicate the sequences of both the template strand and the coding strand, and indicate which are the 3' and 5' ends of each strand.

3a. When this mRNA is translated, what is the sequence of the anticodon of the first activated tRNA that will bind to the mRNA?
3b. What amino acid is covalently bound to this tRNA?
(hint: These answers are the same for every mRNA in the cell.)

4a. If the normal gene for this peptide is mutated so that the first GGG in the template strand becomes GGC, (that is, the third G of this triplet changes to C), what will be the primary sequence of the resulting peptide?
4b. Assuming the polypeptide from the normal gene is essential to proper cell division, how do you predict this mutation will effect the cell division process?

5a. If the normal gene for this peptide is mutated so that the first TGTAT in the coding strand becomes TGTA, (that is, the third T of the TGTAT is lost), what will be the primary sequence of the resulting peptide?
5b. Assuming the peptide from the normal gene is essential to proper cell division, how do you predict this mutation will effect the cell division process?

6. Proteins are translated in a cell because they have particular functions they play in that cell. Let's say a large protein, called "SpliceMe" found in dividing cells is sometimes expressed in a form that binds MPF. Researchers studying the SpliceMe protein found that its MPF-binding domain has the same primary sequence as the Cheer gene. Assuming that the Cheer gene evolved as a functional protein before SpliceMe...
6a. Explain a mechanism whereby the SpliceMe protein can sometimes be expressed without its MPF-binding domain and sometimes with the domain.
6b. Explain how through evolution, the SpliceMe gene might have acquired a domain that binds MPF.

7. MPF is inactivated during the cell cycle by degrading cyclin.
7a. Knowing that Cheer binds to MPF, what might Cheer's function be in order for Cheer to be classified as an oncogene?
7b. Knowing that Cheer binds to MPF, what might Cheer's function be in order for Cheer to be classified as a tumor-suppressor?

Content and design of this site by Dr. Bob Morris. Please direct comments to him at rmorris@wheatonma.edu.
Last updated 04/2004.